Arguments on why string concatenation loops (SCL) is a bad programming practice were given in a previous post.
You can also google for additional arguments against SCL.
We now show a simple PHP code that makes unnecessary SCL when computing DNA reverse complement sequences. Consider the sequence
ATTAAAGGTTTATACCTTCCC
This sequence corresponds to the first 21 nucleotides of the NCBI Reference Sequence NC_045512.2; i.e., to the first 21 nts of the complete genome of the severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2 ).
To compute its reverse complement sequence,
GGGAAGGTATAAACCTTTAAT
we just need to use the following one-liner:
echo strrev(strtr(‘ATTAAAGGTTTATACCTTCCC’, ‘ACGT’, ‘TGCA’));
Voila!
No string splitting, concatenation, or looping are needed!
As I always say, graduate students and postdocs who can code have and edge in multidisciplinary research work over those that cannot code.
IR Thoughts 